In May, researchers around the world cited ImmunoChemistry Technologies’ products in their publications. Explore our selection of May citations from 2021.
Liao, Y;Xu, J;Qin, B;Shi, J;Qin, C;Xie, F;Ou, S;Tang, J;Wang, W;Wu, F;Bai, L. Advanced oxidation protein products impair autophagic flux in macrophage by inducing lysosomal dysfunction via activation of PI3K-Akt-mTOR pathway in Crohn\'s disease. Free radical biology & medicine. 2021 May 21; doi: 10.1016/j.freeradbiomed.2021.05.018. Abstract
"CTSB activity assay. CTSB activity was measured using the Magic Red Cathespin B detection kit (ImmunoChemistry Technologies, 937). Control, RSA or AOPPs-treated RAW264.7 cells were cultured in 12-well plates..."
Long, SR;Liu, RD;Kumar, DV;Wang, ZQ;Su, CW. Immune Protection of a Helminth Protein in the DSS-Induced Colitis Model in Mice. Frontiers in immunology. 2021 April 29; doi: 10.3389/fimmu.2021.664998. Full Article
"To differentiate between apoptotic and necrotic cells, we used carboxyfluorescein (FAM)- fluorochrome-labeled inhibitors of caspases (FLICA) in vitro Caspase Detection Kit (ImmunoChemistry Technologies', Catalog # 92) to assess cell death in vitro Cached ..."
Kolachala, VL;Lopez, C;Shen, M;Shayakhmetov, D;Gupta, NA. Ischemia reperfusion injury induces pyroptosis and mediates injury in steatotic liver thorough Caspase 1 activation. Apoptosis : an international journal on programmed cell death. 2021 May 14; doi: 10.1007/s10495-021-01673-1. Abstract
"Casp 1 Mouse specific primers forward: TCCGCGGTTGAATCCTTTTC, Reverse: CCTTTCCAACAGGGCGTGAA. Pyroptosis/Casapse-1 Assay kit (Cat #9158, from Immunochemistry Technologies, Bloomington, MN). Animals ..."
Rodríguez-Rivera, C;Pérez-Carrión, MD;Olavarría, LC;Alguacil, LF;Mora, MJP;González-Martín, C. Clusterin levels in undernourished SH-SY5Y cells. Food & nutrition research. 2021 May 4; doi: 10.29219/fnr.v65.5709. Publication
"The mitochondrial membrane potential (∆Ψm) was detected using a MitoPTJC-1 detection kit (Immunochemistry Technologies) according to the manufacturer’s protocol, and fluorescence was quantified using a fluorescence plate reader."
Fraser, K. Understanding the Variable Drivers of Toxicity for the Broad Class of Carbon Nanotubes and Nanofibers from U.S. Facilities. West Virginia University Libraries. 2021 May 14; doi: 10.33915/etd.8085. Dissertation
"Active caspase-1 was quantified using a fluorochrome inhibitor of caspase-1 (FAM-YVAD-FMK) (Immunochemistry Technologies, MN; Catalog #98). The differentiated THP-1 cells were challenged with 30 µg/ml (9.37 µg/cm2) of the nine CNT/F for 12 h. The cells were washed with PBS and extracted using Accutase (Thermofisher, CA; #4555-56). The detached cells were collected on ice and then centrifuged at 300 g for 5 min. FAM-YVAD-FMK enters the cells freely and covalently binds to activated caspase-1. The FLICA reagent was diluted as per manufacturers recommendation and incubated with cells ..."
Kenerson, H;Sullivan, K;Labadie, K;Pillarisetty, V;Yeung, R. Protocol for tissue slice cultures from human solid tumors to study therapeutic response. STAR Protocols. 2021 June 1; doi: 10.1016/j.xpro.2021.100574. Text
"UltraPure Low Melting Point Agarose Sigma-Aldrich Cat#16520100 Carboxyfluorescein succinimidyl ester (CFSE) BioLegend Cat#423801 Hoechst 33342 ImmunoChemistry Technologies Cat#639 8-Well culture slide ibidi Cat#80806 Critical commercial assays CellTiter 96®AQueous One Solution Cell Proliferation Assay Promega Cat #G3582 SR-FLICA ImmunohistoChemistry Technologies Cat#932"
Magic Red Cathepsin B Assay Kit
FAM FLICA Poly Caspase Assay Kit
Pyroptosis/Caspase-1 Assay Kit, Far Red
MitoPT JC-1 Assay
FAM FLICA Caspase-1 Assay Kit
Hoechst 33342 Fluorescent Nucleic Acid Stain